New Year's Eve Wishes

2015 is winding down -- how did that happen? It feels as if it had just gotten some momentum. It's been a year of changes for my family, as for many others. Not as rotten a year as 2013 in terms of my personal losses, but not my favorite year, either. Still, there were bright spots and occasions for joy and hope. It's a little like eating horseradish and charoseth at Pesach, the bitter with the sweet.

May we strive together to create a world of peace and justice for everyone. And may we and our loved ones find much to celebrate in the coming year, remembering to be gentle with ourselves and tender with others, most particularly those already burdened with sorrow.

B'shalom, Deborah

TRANSFUSION is An Anthology Builder Best Seller

My first excursion into the wonderful world of making my short fiction available (to those fans who don't have the inclination to rush out and buy dozens of anthologies, not to mention old magazines) was through Anthology Builder. This nifty site allows you to choose from a library of short fiction, pick a cover, and create your own anthology.

Some of the work is in the public domain, such as stories by Jane Austen, Louisa May Alcott, Agatha Christie, and Arthur Conan Doyle. But there's lots more by wonderful contemporary writers like Jay Lake, Mary Robinette Kowal, Maya Kaathryn Bohnhoff, Cat Rambo, Sarah Zettel, Aliette de Bodard, and Ann Leckie (and me!)

I put together a bunch of my best stories, slapped on a nifty cover, and came away with a nicely printed book to offer at conventions and give to family.

Later, I published another collection by the same name (and with the same lead story), available as an ebook from Book View Cafe, Amazon, Barnes & Noble, Kobo, etc. Please to notice, dear friends, that the ToCs are not identical. The Anthology Builder version contains some science fiction, like "Mother Africa" and "Madrelita." Here's the list of the stories.

Transfusion and Other Tales of Hope is listed as one of their best selling pre-made anthologies (although technically it's a collection, since all the stories are mine). What a lovely way to start the new year!

[personal] Goals, Resolutions, Wishes, 2016 version

This blog post is from a few years ago, but it's worth repeating. Be kind to yourselves and your dreams.

I'm not big on resolutions, New Year's or otherwise. More often than not, all they do is set me up to fail, or put me in competition with others, and who needs that? However, I do see a great deal of value in taking some time to clarify where I'm going in my life, if it's where I want to be going, and what I'd like to see different.

Years (as in, decades) ago, a friend suggested making a list of goals instead of resolutions, and to break them down into 1-year, 5-year, 10-year, and lifetime goals. I did that for quite a while, and I still have the notebook I kept them in. It's fascinating to look back at what I thought I wanted, 30 years ago -- what I have achieved, what I no longer want, and what is no longer possible.

Along the way, I realized that some of these things were within my power to achieve, but others were not. I might long for them, but I could not bring them about, or not entirely by my own efforts. For instance, finishing a novel or studying Hebrew are things I can choose to do, but my children being happy, however much I might want to see that come about, is not something I myself can create. These things are wishes, not goals. Of course, many things are both. On my list is to write a work of enduring value -- I can write the best stories that are in me, but how they are received and how they endure the test of time is another matter entirely. I have no say over that.

Four Paws To Light My Way (excerpt)

Tajji

Tajji, our retired seeing eye dog, has made such a difference in our (sighted) lives that I wanted to feature a dog like her in a story. Being a fantasy writer, and one who loves strong women characters, I came up with a blind swordswoman and her guide dog. The whole story appears in Sword and Sorceress 30 (in print and ebook editions at Amazon.com, Barnes & Noble, other venues). Here's the opening:

Four Paws To Light My Way (excerpt)

The curse lay heavy on the Shining City. Jian could smell it in the dust and the sourness of the leaves of the ginkgo trees that lined the approach to the royal palace. They fluttered unseasonably to the ground and crunched under her feet. Here and there, the paving stones, once so level and smoothly joined that she had felt as if she were walking on glass, had buckled. From time to time, Dog nudged her knee in one direction or tugged on the heavy leash in the other, guiding her along the crowded streets.

Dog didn’t like this place. Jian could tell from the stiffness in his muscles, the staccato tapping of his nails on the stones. He preferred bare earth or the windswept hillsides around their home, where wild cattle grazed. Jian did not allow herself the luxury of an opinion; she came when the Emperor commanded, and she would continue to so until he released her from her oath.

The quality of air and sound changed as they passed the outer gates. Here was naked wall, there the many-times-lacquered wood of the gate, here the density of living flesh. Guards would be posted, watchful and still.

Dog slowed, a slackening of the leash. Jian bowed. The guards did not ask her name. How could there be two of her — a blind woman dressed in patched and faded soldier’s garb, a sword in its battered sheath tucked into her sash, a scarf of imperial silk tied around her neck? At least, they were not so foolhardy as to suggest she leave Dog outside the palace.

“Forward,” she said, and Dog guided her inside.

Footsteps on the raked dirt of the courtyard came nearer, then stopped in front of her. She paused, nostrils flaring even though she lacked Dog’s keen sense of smell. There was something familiar about that stride…but she’d been sighted when she’d last heard it.

The Inevitable Consequence of Rain

Rain and more rain. This is good.

Power has gone out. This is predictable. (I live in a forested, mountainous region.)

Backup generator has failed to go on. This is catastrophe.

Wait! My Chromebook battery is all charged so I can write! I can play my piano! I can read a book! I can play with the dog!

(I can have a cold breakfast or go get the Sterno from the emergency supplies...)

Monday Joy

It's raining. This is a good thing. I have yoga class today with a teacher I like very much. This is an even better thing.

What's new and wonderful in your world?

New Story to Read

Click Read A Story for a free short story,"Bread and Arrows," first published in Sword and Sorceress 30, now collected with other short fantasy fiction in Pearls of Fire, Dreams of Steel and available from  Book View Cafe, Amazon.com, and Barnes and Noble)

Kindness in Fictional Characters

"Kind words can be short and easy to speak, but their echoes are truly endless." -- Mark Twain

As I read these words, I am reminded of what William Penn, Quaker and namesake of Pennsylvania, said: "Let us then try what love can do to mend a broken world."

When I talk about kindness and compassion, the state of the world often is the first thing that comes to mind. As I write this, folks are struggling to come to terms with and respond appropriately (or not) to events of spectacular violence. We're all feeling shaken. There's a great deal of public discourse about compassion vs retaliation vs pre-emptive action vs addressing root causes, so there is no need to elaborate here.

Kindness can exist "out there in the world" and it can exist inside ourselves, a quality to be cultivated. It is also an important consideration in the creation and development of fictional characters. First and foremost, just about everyone except sociopaths has some degree of kindness and it manifests to one degree or another in various ways under various circumstances. Sometimes it seems that authors are so fixated on dynamic action or escalating tension or nifty gee-whiz ideas that they forget the role of kindness in every human interaction. (In science fiction and fantasy, this includes non-humans as well!) It may be a small role, or so tiny as to be undetectable, or it may be the dominant emotional axis, but it is always there.

Last night, I was watching a movie and noted that a series of breakneck action scenes was followed by a short catch-your-breath pause. Characters are binding up their wounds, repairing their weapons, that sort of thing. And there was a moment of kindness. Not the expected sort of comforting the injured or checking to see how everyone fared. This moment had more to do with taking that kindness a step further so that the care-taking character could see the good they had done.

Nationally, we talk about the Gross National Product, the total worth of all the products and services produced in one year in a given country. Well, the ones that are typically measured in dollars or shekels or pounds. Some years ago, the King of Bhutan talked about the Gross National Happiness, as if that, too, were something that can be quantified. How about a Gross National Kindness? Or, more specific to story-tellers, the Greater Narrative Kindness?

Kindness isn't about feel-good, let's-all-be-best-friends naive solutions to dramatic problems, or conflicts arising from powerful forces like scarce resources, injustice, blind ambition, or utter evil? It's about small deeds that weave together the lives of the characters, creating and sustaining loyalty and friendship, even devotion. It also isn't an either/or on/off thing.

One way to add depth and complexity, not to mention sympathy, to your characters is to take note of where they are on this spectrum of kindness at any given time and with these particular other characters. The most straightforward presentation is externally observable kind words or deeds. But it might also be that your character is feeling distinctly unkind -- how does that influence his behavior? her speech -- words, tone, contrast with body language? Or your character might be feeling kindness but unable to express it. This opens a host of possibilities for letting the reader know, for revealing and deepening that character.

Or -- and here the potential gets really juicy -- a character who feels no kindness but nevertheless acts in a kind way. Why the discrepancy? Is this an unfeeling person? Or a person who might be kind under other circumstances but not these? Why then behave contrary to genuine feeling? What does she have to gain? And how does the very act of kindness change her?

I'd love to hear your thoughts on the role of kindness in character and story.

GUEST POST: Amy Sterling Casil on "We Can Write Our Lives; We Can Write The World"

Toni Morrison did. She healed vast trauma through her books and is the embodiment of a different way of living. She is her own miracle and that of all of ours, the entire world.

She told The Guardian. “So much contemporary fiction, even when it’s well written is sort of … self-referential. I used to teach creative writing at Princeton and I would say ‘Don’t do that. Don’t write about your little life.”

Toni’s life, Toni’s job has been to be this and she has done it so brilliantly, so perfectly, so magnificently. She wrote others and in doing so she created her incredible self. An impossible person. People who do not see, who are not aware, don’t realize the extraordinary thing she is; more extraordinary than our black President. A Nobel and Pulitzer Prize-winning black woman writer who was a major editor at a major publishing house, an Ivy League professor and mother of two, with more than a dozen bestselling novels of her own. All about black women. Yes, how they were traumatized and brutalized, but also how they transcended. And look at how magnificently she lives, how magnificent she IS.

I hear things. I feel things. I see things. The more aware I am, the more I see and feel and hear. I’ve been tentatively telling people the concept that came into my mind a few weeks ago. What if, I thought — what if when people thought the world was flat, it really was? The time when that was, was in reality — much longer ago than we, today, likely think.

No one saw the globe from space until 1945 when the first hazy image showing a curved horizon appeared. No one had a clear picture of Earth’s true appearance from space until the 1972 “Blue Marble” photo taken from Apollo 17.

Greek people knew that the Earth was round and even accurately calculated its circumference. A thousand years later, this had been largely forgotten. It’s part of our general theoretical concept that we somehow have “progressed” since ancient Greek days.

Scathing Reviews

Like every other published writer I know, my work has garnered rave reviews and anti-rave reviews. (Or perhaps that is rave anti-reviews?) Both ranged from insightful and well thought out to haring off after irrelevancies (like the reader who posted a negative review “not very good” on GoodReads of an unreleased anthology I’d edited and that no one, not even the publisher, had yet seen).  I try to be philosophical about such reviews, keeping in mind that most of them are from amateur reviewers, many of whom have their own axes to grind, as it were. This is not to say that non-professional reviewers cannot produce thoughtful, worthwhile reviews, only that there is no filtering mechanism or gatekeeper to sift out those reviews from the noise. I don’t think it’s necessarily a bad thing to have a wider discussion of books and other media, one that includes more people. In fact, conversations about books are a good thing! Sounding off for its own sake, seeing how mean-spirited and provocative you can be, is another. We call folks who do that trolls, and trolls write book reviews, too.

That said, I recently noticed my own reaction to a scathing review of a movie by a professional reviewer. “Scathing” was the term of the friend who pointed out the review. My friend thought the way the reviewer savaged the film was highly entertaining. I suppose this is what movie reviewers are paid to do – to entertain. But why is it entertaining to show off how clever one is, as if there is a contest to see who can produce the most sarcastic commentary? We don’t tolerate hate speech or bullying, so why do we applaud viciousness in this form?

I don’t believe for a moment that the directors, producers, actors, and all the other folks are deflated by such reviews. For one thing, they make big bucks, even for a film that gets panned. Then there’s the point that any publicity, good or bad, drives sales. Yet I can’t help thinking that somewhere along the line, some of those people loved this project and did their very best. And that some of the folks who saw the film just loved it, too. Or…would have loved it if they had seen it? Or would have loved it if they had not seen it through the lens of a scathing review?

Deborah's EBooks at Your Public Library

If your public library subscribes to Overdrive, you can check out my ebooks. Here's the link to what's available, both traditionally published and through Book View Cafe. (Overdrive carries BVC's entire catalog.)

Paris, Grief, and Healing

Lots of folks have posted on the recent terrorist attack in Paris. I don't have much to add, but I do feel moved to re-post some thoughts from years ago, about 9/11 and the anniversary of my mother's murder, also in September. A few of the references are dated, but the process of coming to terms with trauma remains valid for me.








What has changed for me this year is that I have begun to work for the abolition of the death penalty. Speaking only for myself, I see strong parallels between a murder victim family seeking this form of revenge and the vilification of the Muslim community concurrent with the invasion of Iraq. Of course, justice is desirable. Criminal acts call for appropriate consequences. I would never say that it’s okay for my mother’s killer to walk the streets or that those responsible for the 9/11 attacks should not be prosecuted according to law. Setting aside the politics of that invasion and the problems with the application of capital punishment, however, my concern is with whether retaliative actions help or hinder the recovery of the survivors.

My own experience is that revenge does not. I want to emphasize that I do not speak for anyone else. We all have different experiences. For me, focusing on wishing harm to the one who had harmed my mother might well have kept me locked — incarcerated — in a state of bitterness and hatred. While I was in no way to blame for what happened, I still bear the responsibility for what I do with it. It’s like the adult child of an alcoholic getting herself into therapy instead of whining helplessly, attributing all her problems to her upbringing.

I have to ask myself, What do I need? What do I want? One of my inspirations was a woman of astonishing kindness and grace, whose daughter and son-in-law were murdered and whose bodies she discovered. She told me that she faced a choice of whether or not to let herself be driven crazy by what she experienced. I think we all have that choice — to succumb to the darkness of our anguish and righteous fury, or to walk through it, to move beyond it.

I remember the scene in The Princess Bride where Inigo Montoya finally tracks down Count Rugen, who begs for his life and offers anything. Inigo says, “I want my father back!” (and then kills him). I want my mother back, too. All those who lost loved ones and colleagues want them back. We know that’s impossible, but what is possible is to get our own lives back. Our own selves. Our best selves.

My experience of healing is that I get myself back when I focus on re-engaging with life, on fully experiencing my feelings, on understanding what I have lost and what can never be replaced, but what can be restored. The more I stop looking to an external event (the execution of the murderer) to somehow make me feel better or “achieve closure,” and instead focus on taking care of my insides — my heart, my spirit, my body — the better I fare.

So I’ve been talking about my own healing process and what I’ve learned. I’ve been meeting with other family members and with people who’ve been sentenced to death and then exonerated. I’ve been looking for ways to build bridges, to nourish tolerance and reconciliation, to create understanding. I make an ongoing conscious decision to not harbor hatred in my heart, but to fill it instead with what I want in my life.

Love. Compassion. Gratitude. Joy. Wonder. Peace.

I can think of no more fitting memorial for my mother . . . or for those who died on 9/11.

Today's Work

I just typed:

THE LARAN GAMBIT: A DARKOVER NOVEL

Chapter 1

Now comes the hard part! Or the fun part, as I like to think of it!

How I Became a Reader

Over on the Book View Cafe blog, Sherwood Smith describes her journey as a "passionate reader" (her phrase). She writes how a babysitter brought over a book that ignited that passion:

The story was everything I wanted: kids with no parents, girls getting to adventure as much as boys, no drippy patriotic or moral message in that inimical fifties way of “do what I say, but if you do what I do you’ll be in trouble,” funny stuff as well as action.

I suppose every one of us who loves books has a story. Here are some tidbits from mine. I'd love to hear yours, as well.

I am of an age when kids were expected to learn to read at school, usually in 2nd grade or so. Also, for some reason, I never went to kindergarten (and no one I knew went to preschool, not that my family could have afforded it). I got dumped into first grade with no prior school experience and spent the next couple of years absolutely confused. Reading was opaque to me. I remember struggling with the word "laugh." I just could not translate those letters into anything like a familiar word.

Then in the summer between 2nd and 3rd grades, I was given a discarded reader (3rd grade, I think). I remember the brightly colored pictures and stories I wanted to gobble up. The fairy tale about the hill of glass, and excerpts from books like Understood Betsy (the chapter where she and Molly get left behind at the fair and have to make their way home). These memories are mixed with the rocking chair in which I sat and the sun streaming through my bedroom window. I learned to read that summer because reading gave me entry into wonderful worlds, places I wanted to be, and people I wanted to know more about. I dove into the books on my own shelves. I think that by the time I entered 3rd grade, I was reading and a 5th or 6th grade level.

So what did I read in 5th and 6th grade?

Anything I could get my hands on!

By this time, I was checking out library books and snatching books from the shelves of the classrooms. I read Black Beauty and Robinson Crusoe and Treasure Island  and Stuart Little and Dr. Seuss. And anything with horses or dogs in it: The Black Stallion and the Albert Payson Terhune books featuring collies (Lassie -- the original version with Roddy MacDowell -- was very popular). It wasn't until high school that I tackled Crime and Punishment and then discovered Andre Norton, my gateway drug into fantasy and science fiction.

I don't remember how I came by that reader, but I am so grateful to whoever it was.

How and when did you fall in love with books?

World Fantasy Awards and Jackson's Middle Earth

First and foremost, congratulations to the winners of the World Fantasy Award, and also to the finalists. Many splendid creations here.

Now this post will veer off in a highly personal direction, applying to no one but myself. I have read one of the winners and when I saw the title, I felt a little sick. Do not get me wrong -- the work absolutely deserved the award. It was highly original and superbly executed, a stellar addition to the field.

And it gave the the absolute shakes. There's no way I can see myself ever reading it again. Our local library got my copy.

I've talked with folks who write and love horror about my aversion to it, and I appreciate their point that horror gives us a way of regaining power over the things that terrify us. Once upon a time, I got a delicious thrill out of that adrenaline jolt and the weird, fascinating dark stuff. I don't anymore. I think my threshold has been permanently re-set, and the consequences of exceeding it are more tenacious.

So why am I not pushed over that edge by the violence in the Peter Jackson Middle Earth films? There's plenty of excitement and twenty ways to kill an orc, each sillier and bloodier than the one before, and characters I love in dire peril. Is it the fantastical setting? The characters, even non-humans like Elves and Dwarves, don't feel unreal. Is it the knowledge that all will be well in the end, or as well as can be, given the price various characters play? I still cry at Boromir's death -- he didn't have a happy ending.

And yet, as I wrote in an earlier, watching the films, with all their flaws -- and also reading the books, albeit less vividly -- leaves me with a feeling of peace. Emotionally wrung-out, but brought to a good place by all the adventures I've gone along on.

Truly, we each see and read a different story. They are all colored by what we as individuals bring to them.

Cataract Journey 7: Settling in

It’s been several months (August) since my cataract surgery, and I’m adjusting to my new vision. My eyes have recovered from the surgery and my vision seem to have stabilized. It hasn’t changed noticeably over the last month or so.

So far, my experience continues to be positive. It’s amazing to open my eyes in the morning and be able to see clearly. I haven’t experienced the halos or other visual distortions that some patients with accommodative lenses report. My eyes had gradually become drier and scratchier over the years, and that is slightly improved, although I’m not sure why, maybe all the eye drops I used after the surgery. I’ve talked to other folks who’ve had cataract surgery and reported increased scratchiness afterward (to be fair, once I shared with them my optometrist’s protocol for dry eyes, they said it helped tremendously).

Here’s where I landed, vision-wise. I’ve gone from being incredibly near-sighted to being only slightly near-sighted. I had expected to be able to see clearly at intermediate (computer screen) and distance (driving) ranges, and to need reading glasses for close activities, but that turned out to not be the case. My vision for working at the computer and playing piano is excellent. I can’t remember seeing the piano music so crisply before. I can also read, unless the type is really small or I have to hold the book really close, so I use low-power over-the-counter reading glasses for reading in bed. My distance vision is not so great, especially in my weak eye. I can see well enough to drive places I already know how to get to, but reading street signs requires me to be fairly close to them (the letters and symbols of traffic signs are big enough, so that’s not a problem). I’d likely not pass the driver’s license vision test with my weak eye.

Now it’s time to decide what, if anything, I want to do about the residual near-sightedness.

Guest Blog: More on Transgender Genetics

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

From Open Minded Health:

In the last post, we looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

Peter Jackson’s Middle Earth – Unexpected Gifts

It has often seemed to me that fans of J. R. R. Tolkien’s The Lord of the Rings (and The Hobbit) fall into two categories: those who adore Peter Jackson’s films and those who despise them. I fall into the former category and my husband into the latter. From our conversations, I have concluded that in most cases, it is impossible to change the other person’s mind (not to mention disrespectful to try). This is hardly a problem of cosmic importance, unless one person attempts to drag the other to all six extended cut versions of the movies or prevents the other person from enjoying them. Both sides put forth arguments and reasons, and they are entitled to them. I think just about everything that can be said has already been expounded upon.

I am firmly in the love-them camp. All the objections folks have are absolutely right, and have no relevance to my experience of the movies. The uncritical, immersive, “take me away” quality of my enjoyment of the films has definitely piqued my curiosity. What happens when I spend hours in Jackson’s Middle Earth?

In general, I am far less critical of visual media than of text. Because my own art form is prose, I have developed a keen internal editor and critic that may be regaled to the back seat but never entirely departs. I have no such filters for films or paintings. Only a horrifically bad film can destroy my suspension of disbelief, but horrifically bad films are enjoyable for quite different reasons than good ones.

I devoured Tolkien’s novels as a young adult, although I never wanted to run away to Middle Earth then. I found some aspects of the books frustrating: the “travelogue” passages were often tedious, I had no idea what Tom Bombadil was doing in the story, and I had trouble forming clear images of many of the places, for example Helm’s Deep. Nonetheless, I joined the ranks of fans wearing buttons that said “Frodo Lives!” and “Beware the Balrog.” I stood in line to see the films by Ralph Bakshi and Rankin-Bass (The Hobbit and The Return of the King), all of which I found unsatisfying. The hobbits and dwarves in the animated versions were silly, in bad need of haircuts, and the Bakshi film was just plain weird. The orcs looked like sabertoothed Sand People (from Star Wars), the Balrog was a costume from a bad opera, Boromir looked ridiculous in a Viking helmet, and none of the character moved in a natural way. Et cetera.

I had no idea who Peter Jackson was, but special effects had come a long way since the 1970s. Needless to say, I had excitement but not high hopes. I came prepared to see a live action version of the previous attempts. Five minutes into The Fellowship of the Ring, I was in love. The Jackson films “clicked” for me and brought the stories alive in ways that previous versions, even the original text, fell short.

This is not to say that everyone must feel the same way. Different media and different interpretations work for different people. I’m delighted that some folks prefer Tolkien’s text or even the animated versions. I am also delighted that this one form of presentation worked so well for me. When I go back and re-read the books, I can now immerse myself in the rich and varied landscapes of Middle Earth, and see and hear the characters.

After the extended editions of all three Ring movies came out on DVD (and I had watched all the commentaries and appendices), I set them aside. Every few years, however, I would watch them (3 movies over 2 days, usually, and when my husband – who is in the “doesn’t work for me” camp – was out of town). Either by happenstance or internal prompting, my schedule synchronized with the parole hearings of the man who raped and murdered my mother. That is, I’d gear up for the hearing, get re-traumatized no matter what precautions I took, come home and fall apart, and slowly put myself back together again. Some quality of the Jackson films spoke to me and offered itself as a healing tool.

NaNoWriMo Resources!

Here's a great collection of writing books, from "hot-to" for beginners to the finer points of specific elements, all at a fantastic price. Not only that, but you'll get two of my own essays in Book View Cafe's Brewing Fine Fiction -- one on writing when there is no time, and another on surviving being reviewed!

Book View Cave is delighted to be included in StoryBundle’s 2015 NaNoWriMo Writing Tools Bundle. Not only is ourBrewing Fine Fiction anthology part of the bundle, so are two additional guides by BVC members: Writing Horses by Judith Tarr and Writing Fight Scenes by Marie Brennan.

Never heard of StoryBundle? It’s where you can get fantastic ebooks at one low pay-what-you-want price. DRM-free means you can read them on just about all the devices you own, no matter who makes it.

– Pay the minimum $5 and get Brewing Fine Fiction plus five other great titles.
– Beat the bonus price ($13), and get seven more books including Writing Horses and Writing Fight Scenes.
– Opt into the 2nd tier bonus ($25) and get the 2014 NaNoWriMo bundle as well, for a total of twenty-five fantastic writing books!

Plus Bundle buyers have a chance to donate a portion of their proceeds to charity.

National Novel Writing Month happens every November. Thousands of writers all over the world take up the challenge to produce a novel in a month.

This toolkit offers great advice from a multitude of seasoned professionals including Kevin J. Anderson, Lawrence Block, Algis Budrys, Kristine Kathryn Rusch, Dean Wesley Smith, and Al Zuckerman. Curator Kevin J. Anderson writes:

Here, to get you ramped up for the marathon, I’ve curated a baker’s dozen of instructional books on all aspects of writing, from craft, to productivity, to business, to career advice, to specific areas of expertise. Presenting, for the second year in a row, the NaNoWriMo Writing Tools StoryBundle: a massive batch of useful books that will help you survive—and thrive—during National Novel Writing Month—the full spectrum of useful information. You name your own price, whatever you feel this batch of books is worth, and part of the money you pay goes to help the supportive non-profit NaNoWriMo organization.

I put together these books from the general to the specific, a treasure chest of books vital to your success—not only in writing your novel but in launching your long-term career as a successful writer. This is a toolkit, a drill sergeant, a mentor, and a cheerleading section, all in one.

For complete details and to pick up your bundle, visit 2015 NaNoWriMo Writing Tools Bundle.

GUEST BLOG: Transgender Genetics

From Open Minded Health, early research on the genetic differences between cis and trans men and women. We don't know what these findings mean...yet.

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published!

This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

• There was no difference between trans women and cis men
• Trans men were more likely to have a SNP in their CYP17 than cis women were.
• Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

Kobo Storewide Ebook Sale

Check out my ebooks at the Kobo Storewide Ebook Sale! Here's the link to my books.

Kobo is a multinational ebook vendor and for the next few days they’re offering indie-published ebooks at 50% off. Be aware that Kobo ebooks are in EPUB format only, so you’ll need a compatible e-reader or app.

Here's the skinny:

Customers will be able to redeem 50% off of any title published by KWL using the promo codes below an unlimited number of times—so please, let your readers and fans know about this incredible opportunity to stack up on eBooks while they can! Unlike last time, the sale runs in different dates by territory, and each territory has its own promo code. See below for the full details.

Canada: October 28th – October 31st
Promo Code: CA50SALE

United States/Australia/New Zealand: October 27th – October 30th
Promo Code: GET50SALE

United Kingdom: October 30th – November 2nd
Promo Code: UK50SALE

Promo code is valid for 50% off select eBook purchases from this list. Discount will be confirmed at checkout. Offer valid from October 28, 2015 at 12:00 AM EST through October 31, 2015 at 11:59 PM EST. This offer is not valid in conjunction with any other offer or promotion and cannot be used to adjust amount paid on previous purchases. Promo code must be entered at time of purchase to qualify for this discount. Discounts cannot be applied nor the discount value refunded once a purchase is complete. Rakuten Kobo Inc. reserves the right to change or cancel this offer at any time without notice.

Realms of Darkover Table of Contents

I'm thrilled with this lineup, if I do say so myself, says the editor. Realms of Darkover will be released in May 2016. I'll be posting interviews with the authors and other tidbits as the time approaches.

• Tainted Meat, by Shariann Lewitt           
• Snow Dancing, by Jane M. H. Bigelow
• Impossible Tasks by Marella Sands
• The Snowflake Fallacy, by Michael Spence
• Old Purity, by Leslie Fish
• A Walk In The Mountains, by Margaret L. Carter and Leslie Roy Carter
• The Fifth Moon, by Ty Nolan
• Sudden Tempest, by Deborah Millitello
• Housebound, by Diana L. Paxson
• Sea of Dreams, by Robin Wayne Bailey                                      
• Stormcrow, by Rosemary Edghill and Rebecca Fox
• Fiona, Court Clerk in Training, by Barb Caffrey

Pearls of Fire, Dreams of Steel Story Notes

I love reading "the stories behind the stories," so here are some background musings from the stories

in my new collection from Book View Cafe, Pearls of Fire, Dreams of Steel.

Introduction

As I put together this collection of short fantasy fiction, I realized it comprises a retrospective of my writing career. Although it does not include my very first professional sale (“Imperatrix” in Sword & Sorceress), it spans the decades from novice to seasoned writer. To my delight, I found many of those early stories still spoke to me—delighted me—as much now as when I labored to create them. Often the output of a young writer will be justifiably relegated to the Trunk of Doom (hence the term “trunk stories”). When we’re learning new skills, we need to practice, and not all of those early experiments succeed. More than that, in order to grow as artists, we need to take risks, to “push the envelope,” even if it means falling flat on our faces, so to speak. But it does not follow that every early effort is best forgotten. Stories ignite within us, waiting to take shape on paper. Once we have acquired a certain basic level of craft, it no longer matters if this is our first sale or our fortieth. And one of the gifts of new publishing technologies is the ability to revive those stories, even from decades ago, so that new generations of readers can enjoy them.

“Storm God,” “Fireweb,” and “Dragon-Amber” all come from those early years, when I was trying out lots of new ideas. Astute readers will recognize a touch of a well-known American folk tale in “Storm God.” “Fireweb” was an early exploration of the “wounded healer” theme, and also taught me that whatever I thought a story was “about” when I started writing it, I was sure to be wrong; I developed the wisdom to let the “underneath” story tell itself. When I wrote “Dragon-Amber,” it seemed as if everyone and their cousin was writing stories based on Anne McCaffrey’s “Pern” series. True to my contrary nature, I insisted on something different. No oversized fire-breathing flying reptiles here, but a creature of magic nonetheless.

“Bread and Arrows” and “Nor Iron Bars A Cage” were written within a couple of years of one another. Both stories arose from a turning point in my life. When I wrote it, I had just moved from a large city to a redwood forest. I’d started a full-time day job to support myself and my younger daughter. It’s about new beginnings, and also making choices that close off other avenues. “Bread and Arrows” echoes “Summoning the River” (Transfusion and Other Tales of Hope) in its journey into a dark place, grappling with loss and mortality. I also wanted a different role for the charismatic, sexually attractive stranger; Celine looks beneath the handsome exterior to the suffering man, and draws compassion from her own struggle. And the bakery salamander was irresistible!

GUEST BLOG: Brenda Clough on "Wherefore Art Thou Romeo?" (part 4)

Writer and Book View Cafe member Brenda Clough shares insights on how she comes up with names for characters, places, and more!


Shakespeare mavens know that the question in the blog title does not mean, “Where are you, Romeo?” (Clue: there is no comma between ‘thou’ and ‘Romeo’.) Juliet is asking, “Why are you

Romeo?” Why is a person or a character named what he is named?

Names, even in real life, tell us far more than you would expect. Have a look at this: a study in which scientists can use your name to, possibly, determine your age, your job, what state you live in, even your political leanings. Some fascinating bubble charts here, showing the popularity of certain names over time!

Does this mean that your Republican hero from Decatur, Georgia really has to be named Duane Bailey? Oh, I hope not. Remember what Juliet tells us in the very next line: that a rose by any other name would smell as sweet. People are amazingly sensitive about names, although IMO these people have taken it too far — Heaven ordained nicknames for just their situation. And I would never in a thousand years do this. A contest to name the protagonist? A character with whom I am going to be spending the next year of my mental life, whose every dream, digestive upset, sexual encounter and trauma from birth to grave I am going to invent out of whole cloth? I would never hand over such power to anyone; I shall reign like Alexander, and I shall reign alone.

You can’t pick the name for your hero off a list. (More football coaches are named Michael than Gordon. But not every football coach is named Michael, and there’s probably a Coach Gordon on a gridiron somewhere.) You should think about it. Ponder all the implications well, because now the big data researchers can tell you precisely why it’s not convincing when you change Romeo’s name to Duane..

Brenda W. Clough spent much of her childhood overseas, courtesy of the U.S. government. Her first fantasy novel, The Crystal Crown, was published by DAW in 1984. She has also written The Dragon of Mishbil (1985), The Realm Beneath (1986), and The Name of the Sun (1988). Her children’s novel, An Impossumble Summer (1992), is set in her own house in Virginia, where she lives in a cottage at the edge of a forest.

Her novel How Like a God, forthcoming from Book View Cafe, was published by Tor Books in 1997, and a sequel, Doors of Death and Life, was published in May 2000. Her latest novels from Book View Cafe include Revise the World (2009) and Speak to Our Desires.

Pearl of Fire, Dreams of Steel Table of Contents

Here's the lineup for my forthcoming (October 27) collection of short fantasy stories, from Book View Cafe. Many, but not all, of these stories made their first appearances in the anthology series Sword & Sorceress, many of them under my former name, Deborah Wheeler. For some, this is the first time they've been reprinted anywhere and the original volumes are hard to find. One of the things I love about epublishing is the opportunity to keep gems from the past available to today's readers. 

Bread and Arrows

A Hunter of the Celadon Plains

Storm God

Nor Iron Bars A Cage

Poisoned Dreams

Silverblade

The Sorceress’s Apprentice

Fireweb

Under the Skin

Our Lady of the Toads

Pearl of Fire

Pearl of Tears

Dragon Amber

The Casket of Brass

The Hero of Abarxia

Pearls of Fire, Dreams of Steel Cover Reveal

On October 27 -- that's next Tuesday -- Book View Cafe will release my latest short story collection, Pearls of Fire, Dreams of Steel. I've drawn together short fantasy fiction from over the (many) years of my professional career, choosing stories that still delight me. Here is the cover, designed by Amy Sterling Casil (and I'll post the ToC in just a bit):

What do you think?

BVC's bookstore doesn't permit pre-orders, alas, but I will remind you as the day arrives!

GUEST BLOG: Brenda Clough on Naming Places (part 3)

Writer and Book View Cafe member Brenda Clough shares insights on how she comes up with names for characters, places, and more!


Whatever or whoever your characters are, they need a setting. A country, a town, a space ship, a country-western bar.As with other names, there is a major divide here — the ones that exist in the real world, and the ones that you make up. In this day of interconnectivity, it takes maybe five minutes to find the top-rated Chicago-style pizza restaurant in downtown Ulan Baator or the highlands just outside Luang Prabang. Just fish it up off of Yelp, and send your characters over for a pie and a brew. You can probably view the menu on the restaurant’s web site, look at the street facade through Google, and email the owner for permission to reproduce the sign on the book cover.

But sometimes it is preferable that a place not actually exist in the real world.

[links] Wonderful Things in the Sky and Elsewhere

First, a beautiful image of the Trifid Nebula to brighten your day:

Mountains of opaque dust appear on the right, while other dark filaments of dust are visible threaded throughout the nebula. A single massive star visible near the center causes much of the Trifid's glow.

 Thank you, Hubble Space Telescope!

From Open Minded Health: Article Review: Sexual Orientation Identity Disparities in Awareness and Initiation of the Human Papillomavirus Vaccine Among U.S. Women and Girls

Human Papilloma Virus

Lesbian, bisexual, and straight women had heard of the HPV vaccine. There was no difference there. However, 28% of straight women, 33% of bisexual women and 8.5% of lesbian women received the HPV vaccine. That’s 8.5% of lesbians vs 28-33% of non-lesbian women. Why?? Lesbians are at risk for HPV infection too!

In case you despaired of there being no new animal species left to be discovered, here is a beautiful new species of lemur:

About the size of a small squirrel, the animal weighs 250-310 g. It is reddish-brown in color with a white underside and has brownish-black rings around the eyes.

This galaxy (MBM 54) in the constellation Perseus isn't really awash in dust.  

The faint but pervasive clouds of interstellar dust ride above the galactic plane and dimly reflect the Milky Way's combined starlight. Known as high latitude cirrus or integrated flux nebulae they are associated with molecular clouds.

GUEST BLOG: Brenda Clough on Names in Fantasy and Science Fiction (part 2)

Writer and Book View Cafe member Brenda Clough shares insights on how she comes up with names for characters, places, and more!


You write fantasy or science fiction novels. And, unless you write very philosophical Olaf-Stapledon

type fiction about colliding universes and enormous spans of time, you have created science-fictional or fantasy characters — elves, Klingons, Martians, Wookkies. They need names — and this time you cannot resort to Robert, Mildred and Susie!

This is particularly hard for those of us who need to have the names in hand before starting to write. Because names imply enormous things. We do not notice this so much, because modern Western culture pervades all we see and do so thoroughly. But step out for a moment. You don’t need a rocket ship and FTL to travel to another world. All you need do is learn another language and culture. And suddenly names mean something different. Paul Atreides changes his name to Paul Muad’Dib in Dune. The change of name shows the spiritual change. Or open your newspaper. Some Midwestern kid moved to Syria yesterday and joined ISIS. What did he do, just before that? He changed his name from Jason to Ali.

So, somehow, before you’ve invented the world, figured out the plot, or anything, you need a character. And to handle him you need a handle — a name. In fact in inventing this name all the rest will follow: because the world is encapsulated in the name, and the name embodies character which will inevitably lead you to plot. Pantsers have it hard! But even if you are not a pantser — names are so important that you might well start here as well. J.R.R. Tolkien had Middle Earth and its languages mapped out in fanatical detail long before he sat down to write The Hobbit. But to start that work he needed Bilbo Baggins, who is not (as Gandalf notes) in any of the material about the Eldar at all. All those appendices at the back of LOTR, they were not the story. Bilbo was the story.

Guest Blog: Article Review: Differences in Health Risk Behaviors Across Understudied LGBT Subgroups

From Open Minded Health: 

I’ve been saying for years now that the phrase “LGBT community” is insufficient when it comes to health. It’s not one community — it is multiple communities. The social issues and health issues that a gay transgender man faces every day are different from the issues a bisexual cisgender woman faces every day. There are some similarities and grouping the communities together has been politically useful. But it should never be forgotten that L, G, B, and T all face different types of health concerns and have different civil rights battles to face.

A study came out in August that has to be one of my favorites this year. Researchers in Georgia surveyed over three thousand lesbian, gay, bisexual, pansexual, transgender, gender non-conforming, and queer people. They asked about health behaviors of all kinds. And then they did statistical analysis, comparing the various genders (cis male, cis female, trans male, trans female, genderqueer) and sexual orientations (lesbian, gay, bisexual, pansexual, queer, straight). Let’s look at what they found!

• Diet and exercise: The researchers asked about fatty foods, eating while not hungry, quantity of vegetables and fruits eaten, and about hours and types of exercise. Transgender women had the least healthy diet of all genders. As a group, they were less likely to eat many fruits and vegetables, and more likely to drink sugared drinks and eat when they weren’t hungry. Both cisgender and transgender men were also less likely to eat many vegetables compared with other groups. Genderqueer people and gay cisgender men were most likely to exercise.

GUEST BLOG: Brenda Clough on Naming Characters (Part 1)

Writer and Book View Cafe member Brenda Clough shares insights on how she comes up with names for characters, places, and more! This is the first of a series. Welcome, Brenda!

You write a novel. Naturally it has characters. And those characters need names! Let us set aside for some other day the issue of creating fantasy names, and consider today only naming characters with cognomens that already exist.

Depending upon how you roll, this usually comes very early in the writing process. For me it comes before beginning the writing at all; if I don’t know the character’s name I cannot write. I can get away without looking at my hero for many thousands of words. I was more than halfway through the first draft of How Like A God before I thought to actually cast the authorial gaze upon my hero; I knew what all the other characters looked like because I was using his viewpoint, but he had never done the old look-in-a-mirror stunt. (When I did look I was astonished, and marked the place in the text.)

But there are a number of factors to consider. The most important of course is time and place. A work that takes place on Mars in AD 2502 is going to have a differently-named cast than a work that is set

in 1741 in Wales. Given names especially come and go in fashion in an easily-charted way. You can search on it and kick up sites that will graph for you the popularity of, say, John as a name for boys over the centuries. Certain names are highly redolent of their time. Consider my own. Every Brenda you are ever likely to meet is between 50 and 70, because that was when that given name was in fashion. Nearly all Lindas are the same, whereas a Madison was surely born the year after Splash and is around 30 years old today. You therefore are foolish indeed to name your Elizabethan heroine Brenda or Madison, and if the novel is set in ancient Rome, all I can say is for god’s sake don’t! Rome, like many other non-Western cultures, had its own naming conventions which you should research carefully.

Surnames, if your characters need them, are also a challenge. An old writer trick if you need foreign names is to look up categories of people — sports figures, say, or members of the state legislature, or plumbers. You need a Czech villain? Find the list of the members of the Czechoslovak Olympic soccer team from the 1950s. Plenty of nicely authentic surnames and given names will pop up, and a little slicing and dicing will get you a correctly-named supervillain. The great Georgette Heyer derived all her realistically-English titles for the earls and dukes of her fiction by plundering maps — all the names are obscure villages in the English countryside.

Beyond that, the vagaries of naming a character are mysterious — an art rather than a science. My heroine is staying with an elderly Frenchwoman. When the character was named Solange she was tall. Now she is renamed Cresside, and she is shorter. If I rename her again to Yvette she will be shorter yet. How do I know this? Why is it so? I have no idea. At some point the Muse takes charge of the process, and I have to let her do that. A rose by any other name does not smell quite as sweet.

All names, and in fact all terms and invented places, should be shoved through Google. If someone with your hero’s name was just executed in Beijing for sex crimes, you want to know this. You say nobody will likely notice? It is possible you will sell those Chinese-language rights, you know.

Oh, and one more very important tip: when you change her name from Cresside to Yvette, go through the ms with care. Do a Global Search and Replace, but then reread it. There are sad stories about writers who changed the hero from Richard to Wallace on page 200 but didn’t do a Search and Replace. The readers were confused!

Brenda W. Clough spent much of her childhood overseas, courtesy of the U.S. government. Her first fantasy novel, The Crystal Crown, was published by DAW in 1984. She has also written The Dragon of Mishbil (1985), The Realm Beneath (1986), and The Name of the Sun (1988). Her children’s novel, An Impossumble Summer (1992), is set in her own house in Virginia, where she lives in a cottage at the edge of a forest.

Her novel How Like a God, forthcoming from Book View Cafe, was published by Tor Books in 1997, and a sequel, Doors of Death and Life, was published in May 2000. Her latest novels from Book View Cafe include Revise the World (2009) and Speak to Our Desires.