Transgender and gender diverse teens: How to talk to and support them

Transgender and gender diverse youth have become more visible than ever. How does transgender history inform us about where society is at in the United States?

Jules Gill-Peterson: A lot of the rhetoric around [trans] kids frames them as totally new – most people are getting to know that there are trans youth for the first time. The visibility that we’re dealing with today is pretty unprecedented. But that doesn’t mean [transgender] people themselves haven’t existed before.

One of the challenges that anyone who’s trans faces is coming to an understanding of yourself in a culture that fundamentally doesn’t recognize that you exist. One of the most remarkable things about trans youth is that they’re able to stand up in this world that we’ve created, that gives them no reason to know who they are, and say, “Hey, actually, I know something about myself that none of the adults in my life know.”

I think history can be a really powerful grounding force to give young people a sense of lineage. It’s not like you look back in time and you see yourself reflected, by any means. But I think it can be profoundly reassuring, in a moment of not just political backlash but the general isolation that trans people face in a cis-normative society, to be able to [see] that you’re not the first person to ever go through this. [I think] that is just kind of a powerful message and one that I certainly subscribe to as an adult too, but I can imagine it’s especially important for young people.

What does “cis” mean and where does it come from?

Jules Gill-Peterson: This is actually a term from chemistry. It’s a prefix that you can put in front of words. So is the word “trans.” Trans as a prefix means across – it’s the spatial metaphor moving across something. Cis means on the same side of. At some point on the internet, people started using that word; they were looking for a word to distinguish between people who are trans and people who are not. Cisgendered came to mean that your gender identity matches what was assigned at birth. That being said, it’s not a totally kind of innocent or uncomplicated term. I’m not sure how helpful it is to think of cisgender as something that people need to own up to, for example, in a pronoun circle (when people introduce themselves by name and by the pronouns they prefer).

I think often the pressure for people to [identify] as cis doesn’t make any sense, either. It’s like, well, what makes you cisgender? Did you really go through that long process of deciding if your gender matched what’s on your birth certificate, like trans people have to deal with? I tend to use the word cis in my work to describe large historical structures that created that very obligation in the first place.

[personal] Bragging About My Younger Daughter

My younger daughter, Rose, is finishing up her residency in Family Medicine. She's also a strong advocate for gender and sexual minority patients. And she's just been recognized for her work:

(DEIA - Diversity, Equity, Inclusion, & Access)  

Guest Blog: More on Transgender Genetics

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.

From Open Minded Health:

In the last post, we looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.

There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.

Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)

So — what about this study?

This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”

The results?

Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”

It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.

Want to read the study for yourself? The abstract is publicly available!

GUEST BLOG: Transgender Genetics

From Open Minded Health, early research on the genetic differences between cis and trans men and women. We don't know what these findings mean...yet.

The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published!

This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.

Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.

So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!

Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.

They found multiple things:

• There was no difference between trans women and cis men
• Trans men were more likely to have a SNP in their CYP17 than cis women were.
• Cis men, trans women, and trans men all had the SNP more frequently than cis women

What does that mean?

We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.

Want to read the study for yourself? The abstract is publicly available.

GUEST POST: Body weight and transgender hormone therapy

Open Minded Health is back up and running with a timely report on a study about how the hormones used in gender transition affect body fat:

Hormone therapy for trans people has long been known to change body shape and body fat percentage. But by how much? And how much can be expected in the first year? A European study of 77 trans women and 73 trans men found out!

On average over the first year of hormones…

• Both trans women and trans men gained weight overall. On average they gained around 4-6 pounds (2-3 kg). Both groups started with a BMI around 24 (just barely between normal weight and overweight). For trans men, this weight gain tipped them into the “overweight” category. Trans women stayed in the “normal” weight category.
• Trans women gained body fat and lost muscle mass. Their body fat went up from 24% to 28%. They lost a kilogram (2.2 pounds) of muscle mass.
• Trans men lost body fat and gained muscle mass. Their body fat went down from 34% to 30%. They gained 5 kilograms (11 pounds) of muscle mass.
• There wasn’t much of a significant different in waist sizes.

It may be helpful to remember body fat percentage numbers. For cis women, 21-31% is considered a fit or normal range. For cis men, 14-25% is the fit or normal range. So the trans women in this study started out at an average body fat percentage and stayed there. The trans men in this study started off with too much body fat and stayed there.

During the first year of hormones it seems that around a 4% change in body fat can be expected. Trans men can gain quite a bit of muscle. Trans women will lose some muscle.

As a final note: this was a European study. The hormones used in Europe are different than the ones used in the United States. The results may not be applicable in the United States.

Want to read the study for yourself? The abstract is publicly available!

Guest Blog: Puberty Blockers, Trans Youth, and Bone Loss

Another thought-provoking article from Open Minded Health, this time a review on an article that examines a possible down-side of puberty blockers.

Puberty blockers (“GnRH agonists”) can be extremely helpful for transgender (trans) and gender non-conforming (GNC) children and their families. They are used to “pause” puberty. The pause allows time for negotiation, thought, and discussion. Schools need to be contacted and negotiated with. Families may need time to ask questions and do their own research. The trans/GNC young person is relieved from the distress of an unwanted puberty.

Simply, puberty blockers work by telling the body “It’s not time for puberty yet — stay as a pre-puberty body”. That message keeps ovaries and testes from producing their sex hormones. For young people just beginning puberty, it’s like pressing “pause” on puberty. But they can also be used post-puberty to reduce overall sex hormone levels. So “puberty blockers” can be used as testosterone blockers in trans women. They’re not used often in the United States that way because they’re expensive, but they’re very effective.

Puberty blockers are generally safe. They have been in use for a long time for children with precocious puberty. However there is one unknown that’s been a concern for both parents and their children: Bone health.

GUEST BLOG: Trans Folk, Hormones, and Stress

In the wake of the suicide of a trans youth, I offer this article from the excellent blog, Open Minded Health. It provides evidence that trans people have a better quality of life when their physiology matches their gender identity.

Article Review: Hormonal Treatment Reduces Psychobiological Distress in Gender Identity Disorder, Independently of the Attachment Style (used with permission).

Summary: Research now indicates that cross-sex hormone therapy is associated with a lower cortisol awakening response in trans people, regardless of attachment style. Many confounding variables, however, were present in this study.

Transgender people have long asserted that gender dysphoria can be extremely distressing and that transition, including hormone therapy, helps relieve that dysphoria. Hormone therapy is known to improve self-reported quality of life, as measured by questionnaire. To my knowledge no other study has looked at stress-related biological factors in trans people. Biological factors are important because self-report is notorious for validity problems. This study looked at one such biological factor, called the cortisol awakening response.