Thursday, December 31, 2015

New Year's Eve Wishes

2015 is winding down -- how did that happen? It feels as if it had just gotten some momentum. It's been a year of changes for my family, as for many others. Not as rotten a year as 2013 in terms of my personal losses, but not my favorite year, either. Still, there were bright spots and occasions for joy and hope. It's a little like eating horseradish and charoseth at Pesach, the bitter with the sweet.
May we strive together to create a world of peace and justice for everyone. And may we and our loved ones find much to celebrate in the coming year, remembering to be gentle with ourselves and tender with others, most particularly those already burdened with sorrow.

B'shalom, Deborah

Monday, December 28, 2015

TRANSFUSION is An Anthology Builder Best Seller

My first excursion into the wonderful world of making my short fiction available (to those fans who don't have the inclination to rush out and buy dozens of anthologies, not to mention old magazines) was through Anthology Builder. This nifty site allows you to choose from a library of short fiction, pick a cover, and create your own anthology.

Some of the work is in the public domain, such as stories by Jane Austen, Louisa May Alcott, Agatha Christie, and Arthur Conan Doyle. But there's lots more by wonderful contemporary writers like Jay Lake, Mary Robinette Kowal, Maya Kaathryn Bohnhoff, Cat Rambo, Sarah Zettel, Aliette de Bodard, and Ann Leckie (and me!)

I put together a bunch of my best stories, slapped on a nifty cover, and came away with a nicely printed book to offer at conventions and give to family.

Later, I published another collection by the same name (and with the same lead story), available as an ebook from Book View Cafe, Amazon, Barnes & Noble, Kobo, etc. Please to notice, dear friends, that the ToCs are not identical. The Anthology Builder version contains some science fiction, like "Mother Africa" and "Madrelita." Here's the list of the stories.

Transfusion and Other Tales of Hope is listed as one of their best selling pre-made anthologies (although technically it's a collection, since all the stories are mine). What a lovely way to start the new year!

Sunday, December 27, 2015

[personal] Goals, Resolutions, Wishes, 2016 version

This blog post is from a few years ago, but it's worth repeating. Be kind to yourselves and your dreams.

I'm not big on resolutions, New Year's or otherwise. More often than not, all they do is set me up to fail, or put me in competition with others, and who needs that? However, I do see a great deal of value in taking some time to clarify where I'm going in my life, if it's where I want to be going, and what I'd like to see different.

Years (as in, decades) ago, a friend suggested making a list of goals instead of resolutions, and to break them down into 1-year, 5-year, 10-year, and lifetime goals. I did that for quite a while, and I still have the notebook I kept them in. It's fascinating to look back at what I thought I wanted, 30 years ago -- what I have achieved, what I no longer want, and what is no longer possible.

Along the way, I realized that some of these things were within my power to achieve, but others were not. I might long for them, but I could not bring them about, or not entirely by my own efforts. For instance, finishing a novel or studying Hebrew are things I can choose to do, but my children being happy, however much I might want to see that come about, is not something I myself can create. These things are wishes, not goals. Of course, many things are both. On my list is to write a work of enduring value -- I can write the best stories that are in me, but how they are received and how they endure the test of time is another matter entirely. I have no say over that.

Wednesday, December 23, 2015

Four Paws To Light My Way (excerpt)

Tajji
Tajji, our retired seeing eye dog, has made such a difference in our (sighted) lives that I wanted to feature a dog like her in a story. Being a fantasy writer, and one who loves strong women characters, I came up with a blind swordswoman and her guide dog. The whole story appears in Sword and Sorceress 30 (in print and ebook editions at Amazon.com, Barnes & Noble, other venues). Here's the opening:



Four Paws To Light My Way (excerpt)


The curse lay heavy on the Shining City. Jian could smell it in the dust and the sourness of the leaves of the ginkgo trees that lined the approach to the royal palace. They fluttered unseasonably to the ground and crunched under her feet. Here and there, the paving stones, once so level and smoothly joined that she had felt as if she were walking on glass, had buckled. From time to time, Dog nudged her knee in one direction or tugged on the heavy leash in the other, guiding her along the crowded streets.

Dog didn’t like this place. Jian could tell from the stiffness in his muscles, the staccato tapping of his nails on the stones. He preferred bare earth or the windswept hillsides around their home, where wild cattle grazed. Jian did not allow herself the luxury of an opinion; she came when the Emperor commanded, and she would continue to so until he released her from her oath.

The quality of air and sound changed as they passed the outer gates. Here was naked wall, there the many-times-lacquered wood of the gate, here the density of living flesh. Guards would be posted, watchful and still.

Dog slowed, a slackening of the leash. Jian bowed. The guards did not ask her name. How could there be two of her — a blind woman dressed in patched and faded soldier’s garb, a sword in its battered sheath tucked into her sash, a scarf of imperial silk tied around her neck? At least, they were not so foolhardy as to suggest she leave Dog outside the palace.

“Forward,” she said, and Dog guided her inside.

Footsteps on the raked dirt of the courtyard came nearer, then stopped in front of her. She paused, nostrils flaring even though she lacked Dog’s keen sense of smell. There was something familiar about that stride…but she’d been sighted when she’d last heard it.

Tuesday, December 22, 2015

The Inevitable Consequence of Rain

Rain and more rain. This is good.

Power has gone out. This is predictable. (I live in a forested, mountainous region.)

Backup generator has failed to go on. This is catastrophe.

Wait! My Chromebook battery is all charged so I can write! I can play my piano! I can read a book! I can play with the dog!

(I can have a cold breakfast or go get the Sterno from the emergency supplies...)

Monday, December 21, 2015

Monday Joy

It's raining. This is a good thing. I have yoga class today with a teacher I like very much. This is an even better thing.

What's new and wonderful in your world?

Tuesday, December 15, 2015

Cheering Each Other On


"When someone does something good, applaud!" said Samuel Goldwyn. "You will make two people happy."

The past few years in the science fiction and fantasy communities (no slight to you horror fans, you can have your share) have been rife with insults, denigration of one another's work, and -- not to put too fine a point on it -- downright nastiness. More than once I have wondered why folks who think that tearing down someone else's book will somehow make theirs better. This is not to say there is no place for literary criticism or personal taste. Not every book that's published qualifies as great literature. I've done my share of scratching my head, clueless as to why a book that did nothing for me has made best seller lists. And there are authors I won't read because I find their public statements, actions, or subtext abhorrent. (When Mein Kampf goes off copyright anon, I doubt I'll purchase a copy.) So the discourse about negative reactions to authors and specific books is complex.

I find the reverse to be quite simple. If I enjoyed a book, I like to praise it. Or a movie, or a piece of music, or a painting, or a dance, or any of the thousand other things that light up my day. It might not be perfect, but a thing doesn't have to be flawless to be enjoyable. When I share my private delight with others, I find it makes me even happier. If the other person also loved whatever it is I'm applauding, that's even better. Curious, how human nature works. We all smile together. Our hearts lift.

And of course, whoever created the thing I'm applauding is happy, too. I've been on both sides -- giving and getting applause. How great is that?

The thing about writing is that so much of it is done in solitude, where our fears and self-doubts multiply in the dark. No matter how thick-skinned we tell ourselves we are, we are not immune to gloom. So instead of looking at another writer's success and thinking, "I suck, I'll never be that good" or "There goes my readership" (or reeling under a review or a rejection letter that compared my work unfavorably to a piece by A Bigger Name -- don't laugh, both have happened to me), I remind myself that no matter who wrote it, the world is a better place with this story in it. I'm a happier reader for having found it. Some day, I'll write a story that makes other people this happy. The other author's success shows me that mine is possible. It gives me hope, as well as something to aim for.

Saturday, December 12, 2015

New Story to Read

Click Read A Story for a free short story,"Bread and Arrows," first published in Sword and Sorceress 30, now collected with other short fantasy fiction in Pearls of Fire, Dreams of Steel and available from  Book View CafeAmazon.com, and Barnes and Noble)

Thursday, December 10, 2015

Galaxies Dance to the Death

This image  from the Hubble Space Telescope was so striking, I could not resist sharing it with you.



These two galaxies (NGC 3808A on the right and NGC 3808B on the left) are distorted ("peculiar") by the massive gravitational tides of a near encounter. The one on the right shows areas of new star formation as a result. Eventually, they will merge into a single galaxy. The bridge between them is made up of gas, dust, and stars.

I wonder what the night sky looks like from a planet in either one -- delicious fodder for a science fiction story! Or a fantasy? What will the two galaxies look like in a billion years? Computer modeling can give us a fascinating peek. Meanwhile, (thank you yet again, Hubble!) we get to enjoy this beautiful, dramatic image.

Tuesday, December 8, 2015

Kindness in Fictional Characters

"Kind words can be short and easy to speak, but their echoes are truly endless." -- Mark Twain

As I read these words, I am reminded of what William Penn, Quaker and namesake of Pennsylvania, said: "Let us then try what love can do to mend a broken world."

When I talk about kindness and compassion, the state of the world often is the first thing that comes to mind. As I write this, folks are struggling to come to terms with and respond appropriately (or not) to events of spectacular violence. We're all feeling shaken. There's a great deal of public discourse about compassion vs retaliation vs pre-emptive action vs addressing root causes, so there is no need to elaborate here.

Kindness can exist "out there in the world" and it can exist inside ourselves, a quality to be cultivated. It is also an important consideration in the creation and development of fictional characters. First and foremost, just about everyone except sociopaths has some degree of kindness and it manifests to one degree or another in various ways under various circumstances. Sometimes it seems that authors are so fixated on dynamic action or escalating tension or nifty gee-whiz ideas that they forget the role of kindness in every human interaction. (In science fiction and fantasy, this includes non-humans as well!) It may be a small role, or so tiny as to be undetectable, or it may be the dominant emotional axis, but it is always there.

Last night, I was watching a movie and noted that a series of breakneck action scenes was followed by a short catch-your-breath pause. Characters are binding up their wounds, repairing their weapons, that sort of thing. And there was a moment of kindness. Not the expected sort of comforting the injured or checking to see how everyone fared. This moment had more to do with taking that kindness a step further so that the care-taking character could see the good they had done.

Nationally, we talk about the Gross National Product, the total worth of all the products and services produced in one year in a given country. Well, the ones that are typically measured in dollars or shekels or pounds. Some years ago, the King of Bhutan talked about the Gross National Happiness, as if that, too, were something that can be quantified. How about a Gross National Kindness? Or, more specific to story-tellers, the Greater Narrative Kindness?

Kindness isn't about feel-good, let's-all-be-best-friends naive solutions to dramatic problems, or conflicts arising from powerful forces like scarce resources, injustice, blind ambition, or utter evil? It's about small deeds that weave together the lives of the characters, creating and sustaining loyalty and friendship, even devotion. It also isn't an either/or on/off thing.

One way to add depth and complexity, not to mention sympathy, to your characters is to take note of where they are on this spectrum of kindness at any given time and with these particular other characters. The most straightforward presentation is externally observable kind words or deeds. But it might also be that your character is feeling distinctly unkind -- how does that influence his behavior? her speech -- words, tone, contrast with body language? Or your character might be feeling kindness but unable to express it. This opens a host of possibilities for letting the reader know, for revealing and deepening that character.

Or -- and here the potential gets really juicy -- a character who feels no kindness but nevertheless acts in a kind way. Why the discrepancy? Is this an unfeeling person? Or a person who might be kind under other circumstances but not these? Why then behave contrary to genuine feeling? What does she have to gain? And how does the very act of kindness change her?

I'd love to hear your thoughts on the role of kindness in character and story.

Wednesday, December 2, 2015

GUEST POST: Amy Sterling Casil on "We Can Write Our Lives; We Can Write The World"

Toni Morrison did. She healed vast trauma through her books and is the embodiment of a different way of living. She is her own miracle and that of all of ours, the entire world.

She told The Guardian. “So much contemporary fiction, even when it’s well written is sort of … self-referential. I used to teach creative writing at Princeton and I would say ‘Don’t do that. Don’t write about your little life.”

Toni’s life, Toni’s job has been to be this and she has done it so brilliantly, so perfectly, so magnificently. She wrote others and in doing so she created her incredible self. An impossible person. People who do not see, who are not aware, don’t realize the extraordinary thing she is; more extraordinary than our black President. A Nobel and Pulitzer Prize-winning black woman writer who was a major editor at a major publishing house, an Ivy League professor and mother of two, with more than a dozen bestselling novels of her own. All about black women. Yes, how they were traumatized and brutalized, but also how they transcended. And look at how magnificently she lives, how magnificent she IS.

I hear things. I feel things. I see things. The more aware I am, the more I see and feel and hear. I’ve been tentatively telling people the concept that came into my mind a few weeks ago. What if, I thought — what if when people thought the world was flat, it really was? The time when that was, was in reality — much longer ago than we, today, likely think.

No one saw the globe from space until 1945 when the first hazy image showing a curved horizon appeared. No one had a clear picture of Earth’s true appearance from space until the 1972 “Blue Marble” photo taken from Apollo 17.

Greek people knew that the Earth was round and even accurately calculated its circumference. A thousand years later, this had been largely forgotten. It’s part of our general theoretical concept that we somehow have “progressed” since ancient Greek days.

Monday, November 30, 2015

Scathing Reviews

Like every other published writer I know, my work has garnered rave reviews and anti-rave reviews. (Or perhaps that is rave anti-reviews?) Both ranged from insightful and well thought out to haring off after irrelevancies (like the reader who posted a negative review “not very good” on GoodReads of an unreleased anthology I’d edited and that no one, not even the publisher, had yet seen).  I try to be philosophical about such reviews, keeping in mind that most of them are from amateur reviewers, many of whom have their own axes to grind, as it were. This is not to say that non-professional reviewers cannot produce thoughtful, worthwhile reviews, only that there is no filtering mechanism or gatekeeper to sift out those reviews from the noise. I don’t think it’s necessarily a bad thing to have a wider discussion of books and other media, one that includes more people. In fact, conversations about books are a good thing! Sounding off for its own sake, seeing how mean-spirited and provocative you can be, is another. We call folks who do that trolls, and trolls write book reviews, too.

That said, I recently noticed my own reaction to a scathing review of a movie by a professional reviewer. “Scathing” was the term of the friend who pointed out the review. My friend thought the way the reviewer savaged the film was highly entertaining. I suppose this is what movie reviewers are paid to do – to entertain. But why is it entertaining to show off how clever one is, as if there is a contest to see who can produce the most sarcastic commentary? We don’t tolerate hate speech or bullying, so why do we applaud viciousness in this form?

I don’t believe for a moment that the directors, producers, actors, and all the other folks are deflated by such reviews. For one thing, they make big bucks, even for a film that gets panned. Then there’s the point that any publicity, good or bad, drives sales. Yet I can’t help thinking that somewhere along the line, some of those people loved this project and did their very best. And that some of the folks who saw the film just loved it, too. Or…would have loved it if they had seen it? Or would have loved it if they had not seen it through the lens of a scathing review?

Friday, November 27, 2015

My Love Affair with the Music of The Lord of the Rings

Listening
In an earlier post, I talked about my enthusiasm for Peter Jackson’s films of The Lord of the Rings. One of the things I adored was Howard Shore's music. I ran out and bought the CDs, of course. At first I listened to the music as a way of re-experiencing the movies. I’d done this with other movie music, like The Last of the Mohicans, Shakespeare in Love, Titanic, and all the work of Ennio Morricone. Romantic, evocative music fits the same slot in my brain as Mendelsohn’s “Midsummer Night’s Dream” or his violin concerto, or Tchaikovsky’s “Romeo and Juliet,” Rimsky-Korsakov’s “Scheherazade” suite, or Borodin’s “In the Steppe of Central Asia” (one of the pieces I listened to while writing Shannivar). It’s narrative music, emotive rather than abstract, and I find it marvelous to write to.

Singing
When at long last it was my time to embark upon piano lessons, as a first-time older adult student, I grabbed a copy of the easy piano versions of The Lord of the Rings music. My goal was to play “Into the West.” I was one of those folks in the theater with tears down my cheeks as the song ended. But I was just starting out, I had zero self-confidence, and I wanted to make sure I had the skill to play it well. My teacher and I selected “In Dreams” (which is also the leitmotif for the hobbits) as one of my early pieces. Even in the easy version, it was a challenge. And it had words, words in a key within my limited vocal range.

Like others of my generation, I got caught in the folk scene of the ‘60s and ‘70s, and even taught myself a few chords on the guitar. Although I enjoyed singing in a group, I had become convinced I had a terrible voice. I remember being told as a child that I couldn’t sing. So of course, my voice was strained, thin, unreliable in pitch. With the piano to support my voice, however, along with lots of practice when no one else was in the house, not to mention having an encouraging teacher, I learned how to breathe more deeply and relax my throat. The higher notes became easier and more clear. I added other songs and vocal exercises, which helped my confidence. “Wow,” my teacher said after one class, “who knew you had such a voice?”

Wednesday, November 18, 2015

Deborah's EBooks at Your Public Library

If your public library subscribes to Overdrive, you can check out my ebooks. Here's the link to what's available, both traditionally published and through Book View Cafe. (Overdrive carries BVC's entire catalog.)


Perfectionism in Motherhood, Cooking, and Writing

"As a child, my family's menu consisted of two choices: take it or leave it." -- Buddy Hackett

Just about everyone who reads this smiles, but actually I think they should be screaming. Either/or choices and black-and-white thinking serve none of us well. Either you get an A+ or you are a total failure. Your book is either #1 on the New York Times Bestseller list and wins both the Nebula and Hugo Awards, or it is an abysmal flop. Your marriage is either the stunning example to all humankind or it's crap. Exaggerated like that, it's easy to see the ridiculousness of perfection-or-nothing. But how many times do we see ourselves and our lives through a perfection-tinted lens?

Years ago, when my children were small, I agonized over my many, many lapses in maternal perfection. At times, I was sure that a single moment of inattention or crabbiness had ruined my beautiful babies forever. A friend (who, interestingly enough, was childless herself) gave me a book in which I read that it isn't necessary to be a perfect mother, only a good-enough mother. Was I good enough? Even in my darkest moments, I knew that I was. For all the black marks, I could look at a thousand more times of games played, books read aloud, lullabies sung, trips to the zoo, mommy and me classes in everything from gymnastics to piano, walks along the beach... (And my daughters have grown up to be amazing, strong women, for which I take an eensy amount of credit, the rest being all their doing.)

I've also learned to relax about my cooking. I'm a good cook, although not given to following recipes too closely or attempting anything too fancy. My general approach is to grab a bunch of fresh produce, mostly from our garden, and not overcook it. But from time to time, the results might be edible but are unlikely to be requested again. Then there are the spectacular disasters. I am notorious for burning things in pots, which is what happens when plot ideas strike in the middle of preparing dinner. My best weapon against perfectionism here is a sense of humor. If I can laugh at the inedibility of an experiment (and follow it up with a 30-minute-or-less-from-pantry-staples dish) then it becomes a shared source of merriment. Silly, rather than tragic.

Why then is it so much harder to cut myself some slack when it comes to writing? In my saner moments, I know that no piece of prose is ever perfect. It works or doesn't work or sort-of works or works for some folks but not others. We say "perfect" when it carries us away so completely, we are oblivious to any flaws. But the flaws are there, and another reader (or viewer, or listener) might well find them looming large.

What would it take for me to say, "This is the best I can do right now"? To remember that, as Paul Valery wrote, "a poem is never finished, only abandoned."

Can I trust my creative instincts to know when to let a project rest and come back to it later, when to keep working away, or when to release it to the world, warts and all?

Saturday, November 14, 2015

Paris, Grief, and Healing

Lots of folks have posted on the recent terrorist attack in Paris. I don't have much to add, but I do feel moved to re-post some thoughts from years ago, about 9/11 and the anniversary of my mother's murder, also in September. A few of the references are dated, but the process of coming to terms with trauma remains valid for me.








What has changed for me this year is that I have begun to work for the abolition of the death penalty. Speaking only for myself, I see strong parallels between a murder victim family seeking this form of revenge and the vilification of the Muslim community concurrent with the invasion of Iraq. Of course, justice is desirable. Criminal acts call for appropriate consequences. I would never say that it’s okay for my mother’s killer to walk the streets or that those responsible for the 9/11 attacks should not be prosecuted according to law. Setting aside the politics of that invasion and the problems with the application of capital punishment, however, my concern is with whether retaliative actions help or hinder the recovery of the survivors.

My own experience is that revenge does not. I want to emphasize that I do not speak for anyone else. We all have different experiences. For me, focusing on wishing harm to the one who had harmed my mother might well have kept me locked — incarcerated — in a state of bitterness and hatred. While I was in no way to blame for what happened, I still bear the responsibility for what I do with it. It’s like the adult child of an alcoholic getting herself into therapy instead of whining helplessly, attributing all her problems to her upbringing.

I have to ask myself, What do I need? What do I want? One of my inspirations was a woman of astonishing kindness and grace, whose daughter and son-in-law were murdered and whose bodies she discovered. She told me that she faced a choice of whether or not to let herself be driven crazy by what she experienced. I think we all have that choice — to succumb to the darkness of our anguish and righteous fury, or to walk through it, to move beyond it.

I remember the scene in The Princess Bride where Inigo Montoya finally tracks down Count Rugen, who begs for his life and offers anything. Inigo says, “I want my father back!” (and then kills him). I want my mother back, too. All those who lost loved ones and colleagues want them back. We know that’s impossible, but what is possible is to get our own lives back. Our own selves. Our best selves.

My experience of healing is that I get myself back when I focus on re-engaging with life, on fully experiencing my feelings, on understanding what I have lost and what can never be replaced, but what can be restored. The more I stop looking to an external event (the execution of the murderer) to somehow make me feel better or “achieve closure,” and instead focus on taking care of my insides — my heart, my spirit, my body — the better I fare.

So I’ve been talking about my own healing process and what I’ve learned. I’ve been meeting with other family members and with people who’ve been sentenced to death and then exonerated. I’ve been looking for ways to build bridges, to nourish tolerance and reconciliation, to create understanding. I make an ongoing conscious decision to not harbor hatred in my heart, but to fill it instead with what I want in my life.

Love. Compassion. Gratitude. Joy. Wonder. Peace.

I can think of no more fitting memorial for my mother . . . or for those who died on 9/11.

Friday, November 13, 2015

Writerly Support Goes Both Ways


Some years ago, I struck up a conversation with a young writer at a convention. (I love getting to know other writers, so this is not unusual for me.) One thing led to another, led to lunch, led to getting together on a regular basis, led to frequently chatting online. I cheered her on as she had her first professional sale, and then another, and then a cover story on a prestigious magazine. One of the gifts of such a relationship is not the support I receive from it, but the honor and joy of watching someone else come into her own as an artist, to celebrate her achievements. It's the opposite of Schaudenfreude -- it's taking immense pleasure and pride in the success of someone you have come to care about.

I've written about these lunches here: The Lady (Actual and Honorary) Writers' Lunch


I find such friendships invaluable, and even more so when they shift from "pro/newbie" to one of true peers. Although we may not be in the same place in terms of professional publication, we each bring a wealth of life experiences to the conversation. Often, critical skills develop faster than writing craft, so even a novice writer can provide invaluable feedback.Trust arises from recognition of each other's strengths.

This happened recently, when I was wrestling with the opening of a new novel. I typed "Chapter 1" and then stared at the blank screen. Everything I could come up with for a beginning sentence was -- to put it mildly, just awful. I wouldn't want to read a book that began that way. But because my friend and I were IMing and she often shares thoughts about her creative process and struggles with various aspects of storytelling in a very different style than mine, I felt safe with her. She agreed that my idea wasn't very entrancing (she was very nice about it, for she understands that beginnings are vulnerable times and that this is indeed a process, not the final copy on the editor's desk). Her support lightened the burden of "I'm totally useless and now everyone is going to find out; I'll never write another decent sentence in my life and I have no idea how to begin a novel!" which we both knew to be not true, but the sort of self-doubt that regularly assails writers of all skill levels.

Eventually I calmed down enough to remember one of my tried and true techniques for coming up with titles. I write down every one I can think of, quite quickly so that I get through all the really stupid ones first. I give myself permission to be ridiculous -- and silly -- and quirky -- and by this time, I am usually generating stuff that has some potential. I did the same thing with opening lines, and before long I realized I'd become ensnared by one of my perennial challenges: wrong point of entry. By backing up (in this case) or leaping forward, I can find the place that clicks. 

I went to bed, having written a page or so, and woke up with: "Yes, and this other thing happens and then she gets thrown into jail (on page 2 or 3) and by the time she gets bailed out, her father has been brainwashed..." Okay, this has possibilities!

Thanks, dear friend, for cheering me on through the discouraging part!

Thursday, November 12, 2015

Today's Work

I just typed:

THE LARAN GAMBIT: A DARKOVER NOVEL

Chapter 1



Now comes the hard part! Or the fun part, as I like to think of it!

Tuesday, November 10, 2015

How I Became a Reader

Over on the Book View Cafe blog, Sherwood Smith describes her journey as a "passionate reader" (her phrase). She writes how a babysitter brought over a book that ignited that passion:
The story was everything I wanted: kids with no parents, girls getting to adventure as much as boys, no drippy patriotic or moral message in that inimical fifties way of “do what I say, but if you do what I do you’ll be in trouble,” funny stuff as well as action.

I suppose every one of us who loves books has a story. Here are some tidbits from mine. I'd love to hear yours, as well.

I am of an age when kids were expected to learn to read at school, usually in 2nd grade or so. Also, for some reason, I never went to kindergarten (and no one I knew went to preschool, not that my family could have afforded it). I got dumped into first grade with no prior school experience and spent the next couple of years absolutely confused. Reading was opaque to me. I remember struggling with the word "laugh." I just could not translate those letters into anything like a familiar word.

Then in the summer between 2nd and 3rd grades, I was given a discarded reader (3rd grade, I think). I remember the brightly colored pictures and stories I wanted to gobble up. The fairy tale about the hill of glass, and excerpts from books like Understood Betsy (the chapter where she and Molly get left behind at the fair and have to make their way home). These memories are mixed with the rocking chair in which I sat and the sun streaming through my bedroom window. I learned to read that summer because reading gave me entry into wonderful worlds, places I wanted to be, and people I wanted to know more about. I dove into the books on my own shelves. I think that by the time I entered 3rd grade, I was reading and a 5th or 6th grade level.

So what did I read in 5th and 6th grade?

Anything I could get my hands on!

By this time, I was checking out library books and snatching books from the shelves of the classrooms. I read Black Beauty and Robinson Crusoe and Treasure Island  and Stuart Little and Dr. Seuss. And anything with horses or dogs in it: The Black Stallion and the Albert Payson Terhune books featuring collies (Lassie -- the original version with Roddy MacDowell -- was very popular). It wasn't until high school that I tackled Crime and Punishment and then discovered Andre Norton, my gateway drug into fantasy and science fiction.

I don't remember how I came by that reader, but I am so grateful to whoever it was.

How and when did you fall in love with books?

Monday, November 9, 2015

World Fantasy Awards and Jackson's Middle Earth

First and foremost, congratulations to the winners of the World Fantasy Award, and also to the finalists. Many splendid creations here.

Now this post will veer off in a highly personal direction, applying to no one but myself. I have read one of the winners and when I saw the title, I felt a little sick. Do not get me wrong -- the work absolutely deserved the award. It was highly original and superbly executed, a stellar addition to the field.

And it gave the the absolute shakes. There's no way I can see myself ever reading it again. Our local library got my copy.

I've talked with folks who write and love horror about my aversion to it, and I appreciate their point that horror gives us a way of regaining power over the things that terrify us. Once upon a time, I got a delicious thrill out of that adrenaline jolt and the weird, fascinating dark stuff. I don't anymore. I think my threshold has been permanently re-set, and the consequences of exceeding it are more tenacious.

So why am I not pushed over that edge by the violence in the Peter Jackson Middle Earth films? There's plenty of excitement and twenty ways to kill an orc, each sillier and bloodier than the one before, and characters I love in dire peril. Is it the fantastical setting? The characters, even non-humans like Elves and Dwarves, don't feel unreal. Is it the knowledge that all will be well in the end, or as well as can be, given the price various characters play? I still cry at Boromir's death -- he didn't have a happy ending.

And yet, as I wrote in an earlier, watching the films, with all their flaws -- and also reading the books, albeit less vividly -- leaves me with a feeling of peace. Emotionally wrung-out, but brought to a good place by all the adventures I've gone along on.

Truly, we each see and read a different story. They are all colored by what we as individuals bring to them.

Friday, November 6, 2015

Cataract Journey 7: Settling in

It’s been several months (August) since my cataract surgery, and I’m adjusting to my new vision. My eyes have recovered from the surgery and my vision seem to have stabilized. It hasn’t changed noticeably over the last month or so.

So far, my experience continues to be positive. It’s amazing to open my eyes in the morning and be able to see clearly. I haven’t experienced the halos or other visual distortions that some patients with accommodative lenses report. My eyes had gradually become drier and scratchier over the years, and that is slightly improved, although I’m not sure why, maybe all the eye drops I used after the surgery. I’ve talked to other folks who’ve had cataract surgery and reported increased scratchiness afterward (to be fair, once I shared with them my optometrist’s protocol for dry eyes, they said it helped tremendously).

Here’s where I landed, vision-wise. I’ve gone from being incredibly near-sighted to being only slightly near-sighted. I had expected to be able to see clearly at intermediate (computer screen) and distance (driving) ranges, and to need reading glasses for close activities, but that turned out to not be the case. My vision for working at the computer and playing piano is excellent. I can’t remember seeing the piano music so crisply before. I can also read, unless the type is really small or I have to hold the book really close, so I use low-power over-the-counter reading glasses for reading in bed. My distance vision is not so great, especially in my weak eye. I can see well enough to drive places I already know how to get to, but reading street signs requires me to be fairly close to them (the letters and symbols of traffic signs are big enough, so that’s not a problem). I’d likely not pass the driver’s license vision test with my weak eye.

Now it’s time to decide what, if anything, I want to do about the residual near-sightedness.

Wednesday, November 4, 2015

Guest Blog: More on Transgender Genetics

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.
In the last post, we looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.
There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.
Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)
So — what about this study?
This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”
The results?
Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”
It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.
Want to read the study for yourself? The abstract is publicly available!

Tuesday, November 3, 2015

Peter Jackson’s Middle Earth – Unexpected Gifts



It has often seemed to me that fans of J. R. R. Tolkien’s The Lord of the Rings (and The Hobbit) fall into two categories: those who adore Peter Jackson’s films and those who despise them. I fall into the former category and my husband into the latter. From our conversations, I have concluded that in most cases, it is impossible to change the other person’s mind (not to mention disrespectful to try). This is hardly a problem of cosmic importance, unless one person attempts to drag the other to all six extended cut versions of the movies or prevents the other person from enjoying them. Both sides put forth arguments and reasons, and they are entitled to them. I think just about everything that can be said has already been expounded upon.

I am firmly in the love-them camp. All the objections folks have are absolutely right, and have no relevance to my experience of the movies. The uncritical, immersive, “take me away” quality of my enjoyment of the films has definitely piqued my curiosity. What happens when I spend hours in Jackson’s Middle Earth?

In general, I am far less critical of visual media than of text. Because my own art form is prose, I have developed a keen internal editor and critic that may be regaled to the back seat but never entirely departs. I have no such filters for films or paintings. Only a horrifically bad film can destroy my suspension of disbelief, but horrifically bad films are enjoyable for quite different reasons than good ones.

I devoured Tolkien’s novels as a young adult, although I never wanted to run away to Middle Earth then. I found some aspects of the books frustrating: the “travelogue” passages were often tedious, I had no idea what Tom Bombadil was doing in the story, and I had trouble forming clear images of many of the places, for example Helm’s Deep. Nonetheless, I joined the ranks of fans wearing buttons that said “Frodo Lives!” and “Beware the Balrog.” I stood in line to see the films by Ralph Bakshi and Rankin-Bass (The Hobbit and The Return of the King), all of which I found unsatisfying. The hobbits and dwarves in the animated versions were silly, in bad need of haircuts, and the Bakshi film was just plain weird. The orcs looked like sabertoothed Sand People (from Star Wars), the Balrog was a costume from a bad opera, Boromir looked ridiculous in a Viking helmet, and none of the character moved in a natural way. Et cetera.

I had no idea who Peter Jackson was, but special effects had come a long way since the 1970s. Needless to say, I had excitement but not high hopes. I came prepared to see a live action version of the previous attempts. Five minutes into The Fellowship of the Ring, I was in love. The Jackson films “clicked” for me and brought the stories alive in ways that previous versions, even the original text, fell short.

This is not to say that everyone must feel the same way. Different media and different interpretations work for different people. I’m delighted that some folks prefer Tolkien’s text or even the animated versions. I am also delighted that this one form of presentation worked so well for me. When I go back and re-read the books, I can now immerse myself in the rich and varied landscapes of Middle Earth, and see and hear the characters.

After the extended editions of all three Ring movies came out on DVD (and I had watched all the commentaries and appendices), I set them aside. Every few years, however, I would watch them (3 movies over 2 days, usually, and when my husband – who is in the “doesn’t work for me” camp – was out of town). Either by happenstance or internal prompting, my schedule synchronized with the parole hearings of the man who raped and murdered my mother. That is, I’d gear up for the hearing, get re-traumatized no matter what precautions I took, come home and fall apart, and slowly put myself back together again. Some quality of the Jackson films spoke to me and offered itself as a healing tool.

Monday, November 2, 2015

Guest blog: Chaz Brenchley Steampunks Mars (With Added Hockey Sticks)

Chaz Brenchley is an amazing writer -- I've been an unabashed fan ever since I read Bridge of Dreams, which led me to write to him, begging for a story for my editorial debut, Lace and Blade. (That story, "In the Night Street Baths," was reprinted in Wild Stories 2009.) Now, many literary adventures later, Chaz sets his sights on Mars, complete with steampunk and a girl's boarding school placed in a failed hotel that was once a Norman castle. Read on for the delicious details...

One of the joys of living in the heart of Silicon Valley is that NASA Ames is just over there, and SETI HQ is even Chaz Brenchleycloser. We live among the cool kids - and the cool kids like to share. I went to NASA for the recent transit of Venus; and ever since I moved here, I’ve been going to SETI’s weekly colloquium where planetary scientists and cosmologists talk about the latest discoveries, or the specific projects they have on a new mission, or the latest weird theory that’s almost a guaranteed Nobel prize if it should ever prove true (“but right now there are only two people who believe it, and they’re both in this room”), and like that.
So there I was with planetary scientists at my fingers’ ends for the asking, and lots of Mars talk going on around the time of Curiosity’s landing, so it’s really no wonder that I started thinking about Mars fiction. Real Mars, not so much, for it is dry and inhospitable and I have written my desert books already - but old Mars, Mars with canals and an atmosphere and aliens? Oh, yes. Very much yes.
And very much within that spirit, I wanted to steampunk it up a bit; and there was a lot of talk at that time in my social media about how steampunk tended to assume British Empire overtones, as though that were the only choice, and how it so very much was not. So I thought somewhat about that - but I did keep coming back to the British Empire, because I am far from home and the more time I spend in California the more inveterately Brit I become, and because I am the son of an Empire brat (Grandad was a major in the Scots Guards; Mum was born in Rangoon and grew up in Kuala Lumpur and Singapore, speaking Malay more readily than English), and because above all I was really curious. If Mars were a province of the British Empire, how would that actually work? How could it happen, and what would it mean - to the Empire, and to European and world history? And to Mars, and to the presumptive Martians? How do you impose colonial rule on a race that has no concept of empire, or statehood, or governance? And does it make a difference if you’re there by their courtesy, via their aetherships, for reasons you still don’t understand? And how do you negotiate even the broadest heads of agreement where you can barely communicate at all? 

Sunday, November 1, 2015

NaNoWriMo Resources!

Here's a great collection of writing books, from "hot-to" for beginners to the finer points of specific elements, all at a fantastic price. Not only that, but you'll get two of my own essays in Book View Cafe's Brewing Fine Fiction -- one on writing when there is no time, and another on surviving being reviewed!




NaNoWriMo-storybundle-covers


Book View Cave is delighted to be included in StoryBundle’s 2015 NaNoWriMo Writing Tools Bundle. Not only is ourBrewing Fine Fiction anthology part of the bundle, so are two additional guides by BVC members: Writing Horses by Judith Tarr and Writing Fight Scenes by Marie Brennan.

Never heard of StoryBundle? It’s where you can get fantastic ebooks at one low pay-what-you-want price. DRM-free means you can read them on just about all the devices you own, no matter who makes it.

– Pay the minimum $5 and get Brewing Fine Fiction plus five other great titles.
– Beat the bonus price ($13), and get seven more books including Writing Horses and Writing Fight Scenes.
– Opt into the 2nd tier bonus ($25) and get the 2014 NaNoWriMo bundle as well, for a total of twenty-five fantastic writing books!

Plus Bundle buyers have a chance to donate a portion of their proceeds to charity.

National Novel Writing Month happens every November. Thousands of writers all over the world take up the challenge to produce a novel in a month.

This toolkit offers great advice from a multitude of seasoned professionals including Kevin J. Anderson, Lawrence Block, Algis Budrys, Kristine Kathryn Rusch, Dean Wesley Smith, and Al Zuckerman. Curator Kevin J. Anderson writes:

Here, to get you ramped up for the marathon, I’ve curated a baker’s dozen of instructional books on all aspects of writing, from craft, to productivity, to business, to career advice, to specific areas of expertise. Presenting, for the second year in a row, the NaNoWriMo Writing Tools StoryBundle: a massive batch of useful books that will help you survive—and thrive—during National Novel Writing Month—the full spectrum of useful information. You name your own price, whatever you feel this batch of books is worth, and part of the money you pay goes to help the supportive non-profit NaNoWriMo organization.

I put together these books from the general to the specific, a treasure chest of books vital to your success—not only in writing your novel but in launching your long-term career as a successful writer. This is a toolkit, a drill sergeant, a mentor, and a cheerleading section, all in one.

For complete details and to pick up your bundle, visit 2015 NaNoWriMo Writing Tools Bundle.

Friday, October 30, 2015

GUEST BLOG: Transgender Genetics

From Open Minded Health, early research on the genetic differences between cis and trans men and women. We don't know what these findings mean...yet.









The science of transgender is still in its infancy, but evidence so far points to it being biological. Differences in brain have been seen, and I’ve covered them before here on OMH. However, genetic evidence is also being published!
This week, let’s take a look at CYP17. CYP17 is a gene that makes enzymes that are part of sex hormone synthesis. Mutations in CYP17 have been noted in some intersex conditions, such as adrenal hyperplasia.
Now, there’s a SNP that’s been noticed in CYP17. SNPs are “single nucleotide polymorphisms”, which takes some explaining. SNPs are very, very tiny mutations in genes — just one letter in the DNA alphabet changes! SNPs don’t usually change the protein that the gene makes very much.
So we have this gene — CYP17, that is involved in making sex hormones. And we have this tiny mutation, this SNP. Now let’s look at the science!
Specifically, let’s look at this one study that was published back in 2008. They looked at the CYP17 gene in 102 trans women, 49 trans men, 756 cis men, and 915 cis women. They compared the CYP17 of trans women to cis men, and trans men to cis women. Unlike many studies, this comparison makes sense. We’re talking about the DNA in the genes here, not something that’s changed by hormonal status.
They found multiple things:
  • There was no difference between trans women and cis men
  • Trans men were more likely to have a SNP in their CYP17 than cis women were.
  • Cis men, trans women, and trans men all had the SNP more frequently than cis women
What does that mean?
We don’t know yet. But it does appear that CYP17 is a gene that it might be worth looking deeper into to find potential causes for transgender.
Want to read the study for yourself? The abstract is publicly available.

Wednesday, October 28, 2015

Kobo Storewide Ebook Sale

Check out my ebooks at the Kobo Storewide Ebook Sale! Here's the link to my books.

Kobo is a multinational ebook vendor and for the next few days they’re offering indie-published ebooks at 50% off. Be aware that Kobo ebooks are in EPUB format only, so you’ll need a compatible e-reader or app.


Here's the skinny:


Customers will be able to redeem 50% off of any title published by KWL using the promo codes below an unlimited number of times—so please, let your readers and fans know about this incredible opportunity to stack up on eBooks while they can! Unlike last time, the sale runs in different dates by territory, and each territory has its own promo code. See below for the full details.

Canada: October 28th – October 31st
Promo Code: CA50SALE

United States/Australia/New Zealand: October 27th – October 30th
Promo Code: GET50SALE

United Kingdom: October 30th – November 2nd
Promo Code: UK50SALE
Promo code is valid for 50% off select eBook purchases from this list. Discount will be confirmed at checkout. Offer valid from October 28, 2015 at 12:00 AM EST through October 31, 2015 at 11:59 PM EST. This offer is not valid in conjunction with any other offer or promotion and cannot be used to adjust amount paid on previous purchases. Promo code must be entered at time of purchase to qualify for this discount. Discounts cannot be applied nor the discount value refunded once a purchase is complete. Rakuten Kobo Inc. reserves the right to change or cancel this offer at any time without notice.

Realms of Darkover Table of Contents



I'm thrilled with this lineup, if I do say so myself, says the editor. Realms of Darkover will be released in May 2016. I'll be posting interviews with the authors and other tidbits as the time approaches.


  • Tainted Meat, by Shariann Lewitt           
  • Snow Dancing, by Jane M. H. Bigelow
  • Impossible Tasks by Marella Sands
  • The Snowflake Fallacy, by Michael Spence
  • Old Purity, by Leslie Fish
  • A Walk In The Mountains, by Margaret L. Carter and Leslie Roy Carter
  • The Fifth Moon, by Ty Nolan
  • Sudden Tempest, by Deborah Millitello
  • Housebound, by Diana L. Paxson
  • Sea of Dreams, by Robin Wayne Bailey                                      
  • Stormcrow, by Rosemary Edghill and Rebecca Fox
  • Fiona, Court Clerk in Training, by Barb Caffrey

Tuesday, October 27, 2015

Pearls of Fire, Dreams of Steel Story Notes

I love reading "the stories behind the stories," so here are some background musings from the stories
in my new collection from Book View Cafe, Pearls of Fire, Dreams of Steel.

Introduction

As I put together this collection of short fantasy fiction, I realized it comprises a retrospective of my writing career. Although it does not include my very first professional sale (“Imperatrix” in Sword & Sorceress), it spans the decades from novice to seasoned writer. To my delight, I found many of those early stories still spoke to me—delighted me—as much now as when I labored to create them. Often the output of a young writer will be justifiably relegated to the Trunk of Doom (hence the term “trunk stories”). When we’re learning new skills, we need to practice, and not all of those early experiments succeed. More than that, in order to grow as artists, we need to take risks, to “push the envelope,” even if it means falling flat on our faces, so to speak. But it does not follow that every early effort is best forgotten. Stories ignite within us, waiting to take shape on paper. Once we have acquired a certain basic level of craft, it no longer matters if this is our first sale or our fortieth. And one of the gifts of new publishing technologies is the ability to revive those stories, even from decades ago, so that new generations of readers can enjoy them.

“Storm God,” “Fireweb,” and “Dragon-Amber” all come from those early years, when I was trying out lots of new ideas. Astute readers will recognize a touch of a well-known American folk tale in “Storm God.” “Fireweb” was an early exploration of the “wounded healer” theme, and also taught me that whatever I thought a story was “about” when I started writing it, I was sure to be wrong; I developed the wisdom to let the “underneath” story tell itself. When I wrote “Dragon-Amber,” it seemed as if everyone and their cousin was writing stories based on Anne McCaffrey’s “Pern” series. True to my contrary nature, I insisted on something different. No oversized fire-breathing flying reptiles here, but a creature of magic nonetheless.

“Bread and Arrows” and “Nor Iron Bars A Cage” were written within a couple of years of one another. Both stories arose from a turning point in my life. When I wrote it, I had just moved from a large city to a redwood forest. I’d started a full-time day job to support myself and my younger daughter. It’s about new beginnings, and also making choices that close off other avenues. “Bread and Arrows” echoes “Summoning the River” (Transfusion and Other Tales of Hope) in its journey into a dark place, grappling with loss and mortality. I also wanted a different role for the charismatic, sexually attractive stranger; Celine looks beneath the handsome exterior to the suffering man, and draws compassion from her own struggle. And the bakery salamander was irresistible!

Monday, October 26, 2015

GUEST BLOG: Brenda Clough on "Wherefore Art Thou Romeo?" (part 4)

Writer and Book View Cafe member Brenda Clough shares insights on how she comes up with names for characters, places, and more!


Shakespeare mavens know that the question in the blog title does not mean, “Where are you, Romeo?” (Clue: there is no comma between ‘thou’ and ‘Romeo’.) Juliet is asking, “Why are you
Romeo?” Why is a person or a character named what he is named?

Names, even in real life, tell us far more than you would expect. Have a look at this: a study in which scientists can use your name to, possibly, determine your age, your job, what state you live in, even your political leanings. Some fascinating bubble charts here, showing the popularity of certain names over time!

Does this mean that your Republican hero from Decatur, Georgia really has to be named Duane Bailey? Oh, I hope not. Remember what Juliet tells us in the very next line: that a rose by any other name would smell as sweet. People are amazingly sensitive about names, although IMO these people have taken it too far — Heaven ordained nicknames for just their situation. And I would never in a thousand years do this. A contest to name the protagonist? A character with whom I am going to be spending the next year of my mental life, whose every dream, digestive upset, sexual encounter and trauma from birth to grave I am going to invent out of whole cloth? I would never hand over such power to anyone; I shall reign like Alexander, and I shall reign alone.

You can’t pick the name for your hero off a list. (More football coaches are named Michael than Gordon. But not every football coach is named Michael, and there’s probably a Coach Gordon on a gridiron somewhere.) You should think about it. Ponder all the implications well, because now the big data researchers can tell you precisely why it’s not convincing when you change Romeo’s name to Duane..

Brenda W. Clough spent much of her childhood overseas, courtesy of the U.S. government. Her first fantasy novel, The Crystal Crown, was published by DAW in 1984. She has also written The Dragon of Mishbil (1985), The Realm Beneath (1986), and The Name of the Sun (1988). Her children’s novel, An Impossumble Summer (1992), is set in her own house in Virginia, where she lives in a cottage at the edge of a forest.
Her novel How Like a God, forthcoming from Book View Cafe, was published by Tor Books in 1997, and a sequel, Doors of Death and Life, was published in May 2000. Her latest novels from Book View Cafe include Revise the World (2009) and Speak to Our Desires.

Sunday, October 25, 2015

Pearl of Fire, Dreams of Steel Table of Contents

Here's the lineup for my forthcoming (October 27) collection of short fantasy stories, from Book View Cafe. Many, but not all, of these stories made their first appearances in the anthology series Sword & Sorceress, many of them under my former name, Deborah Wheeler. For some, this is the first time they've been reprinted anywhere and the original volumes are hard to find. One of the things I love about epublishing is the opportunity to keep gems from the past available to today's readers. 







Bread and Arrows
A Hunter of the Celadon Plains
Storm God
Nor Iron Bars A Cage
Poisoned Dreams
Silverblade
The Sorceress’s Apprentice
Fireweb
Under the Skin
Our Lady of the Toads
Pearl of Fire
Pearl of Tears
Dragon Amber
The Casket of Brass
The Hero of Abarxia

Friday, October 23, 2015

Pearls of Fire, Dreams of Steel Cover Reveal

On October 27 -- that's next Tuesday -- Book View Cafe will release my latest short story collection, Pearls of Fire, Dreams of Steel. I've drawn together short fantasy fiction from over the (many) years of my professional career, choosing stories that still delight me. Here is the cover, designed by Amy Sterling Casil (and I'll post the ToC in just a bit):





What do you think?

BVC's bookstore doesn't permit pre-orders, alas, but I will remind you as the day arrives!